Amplicon-seq
Amplicon sequencing is a highly focused NGS approach that allows in-depth analysis of specific genomic regions of interest. This technique is ideal for applications such as mutation detection, microbial diversity studies, and the identification of genetic variants. It requires the amplification of target regions using PCR, followed by NGS to generate high-resolution data.
The ATGC offers a flexible PCR amplicon sequencing workflow from user-provided PCR amplicons. For amplicon-seq at the ATGC, the PCR primers must contain the following over-hang sequences:
Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus‐specific sequence]
Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus‐specific sequence]
Sample are submitted as PCR reactions, no clean-up steps required.
Before submitting samples for amplicon-seq, please review our samples delivery instructions and send us your sample submission form.
The sequencing data is sent via Illumina Basespace cloud. Please open an account and indicate the email address associated with your account in the sample submission form. Instructions on how to open an account and manage your data in the cloud.
For additional information, please contact:
Liat Linde, Head
Rappaport Building: 073-3785452
Emerson Building: 073-3785168
Nitsan Fourier, Lab manager